Barry Rowlingson on Nostr: It might get asked "How many C base pairs are in the DNA sequence ...
It might get asked "How many C base pairs are in the DNA sequence CCTGAGATCTAGGAGGGCATCCGC?"
Barry Rowlingson /
npub1r5r…u33l
2024-08-08 19:17:47
in reply to nevent1q…jwjs
Author Public Key
npub1r5rwzap94w0wl2v9dcq8zagyakrukgu82tnwqsprd8xwyf6jxv2snfu33lPublished at
2024-08-08 19:17:47Event JSON
{
"id": "25dad730c21908c6f14a22e2fece332236c9f9f7029cc6c190af608b9307e506",
"pubkey": "1d06e17425ab9eefa9856e00717504ed87cb238752e6e0402369cce227523315",
"created_at": 1723144667,
"kind": 1,
"tags": [
[
"p",
"537160b7414f9aa915e0c678c7f38c1b9b167a2a4f479afdc28014010228e9db"
],
[
"p",
"22be5cce24796611eca432d59a65a4ef87a66982b00a61ddeac224780e693e1c"
],
[
"e",
"35d4f896956e307b486e6f3723fbfa131c51df5fbcea5834fa77938c971c95e9",
"",
"reply",
"537160b7414f9aa915e0c678c7f38c1b9b167a2a4f479afdc28014010228e9db"
],
[
"p",
"302d7e5736a0dfdcf0dd04e6ca5b07b83ebfd32c36aafa286086f404071f6d83"
],
[
"e",
"760274228f074391ba7976a565f534036337bb9be297f98bcb57ef635ee6d54d",
"",
"root",
"22be5cce24796611eca432d59a65a4ef87a66982b00a61ddeac224780e693e1c"
],
[
"proxy",
"https://mastodon.social/@geospacedman/112928008959421323",
"web"
],
[
"proxy",
"https://mastodon.social/users/geospacedman/statuses/112928008959421323",
"activitypub"
],
[
"L",
"pink.momostr"
],
[
"l",
"pink.momostr.activitypub:https://mastodon.social/users/geospacedman/statuses/112928008959421323",
"pink.momostr"
],
[
"-"
]
],
"content": "It might get asked \"How many C base pairs are in the DNA sequence CCTGAGATCTAGGAGGGCATCCGC?\"",
"sig": "02998d6c3b7bce3cb5eba576c4162e5a041350b267645e9dc52b182151284920cc81895e54747e7ce9bdf62c40c72f39041806dd5ecf31fda429ed356409c9d4"
}